![Biosensors | Free Full-Text | Development of a Novel Phagomagnetic-Assisted Isothermal DNA Amplification System for Endpoint Electrochemical Detection of Listeria monocytogenes Biosensors | Free Full-Text | Development of a Novel Phagomagnetic-Assisted Isothermal DNA Amplification System for Endpoint Electrochemical Detection of Listeria monocytogenes](https://pub.mdpi-res.com/biosensors/biosensors-13-00464/article_deploy/html/images/biosensors-13-00464-g001.png?1681371572)
Biosensors | Free Full-Text | Development of a Novel Phagomagnetic-Assisted Isothermal DNA Amplification System for Endpoint Electrochemical Detection of Listeria monocytogenes
![Frontiers | Reverse Transcription Recombinase-Aided Amplification Assay With Lateral Flow Dipstick Assay for Rapid Detection of 2019 Novel Coronavirus Frontiers | Reverse Transcription Recombinase-Aided Amplification Assay With Lateral Flow Dipstick Assay for Rapid Detection of 2019 Novel Coronavirus](https://www.frontiersin.org/files/Articles/613304/fcimb-11-613304-HTML/image_m/fcimb-11-613304-g001.jpg)
Frontiers | Reverse Transcription Recombinase-Aided Amplification Assay With Lateral Flow Dipstick Assay for Rapid Detection of 2019 Novel Coronavirus
![SorTn-seq: a high-throughput functional genomics approach to discovering regulators of bacterial gene expression | Nature Protocols SorTn-seq: a high-throughput functional genomics approach to discovering regulators of bacterial gene expression | Nature Protocols](https://media.springernature.com/lw685/springer-static/image/art%3A10.1038%2Fs41596-021-00582-6/MediaObjects/41596_2021_582_Fig2_HTML.png)
SorTn-seq: a high-throughput functional genomics approach to discovering regulators of bacterial gene expression | Nature Protocols
Karen Juntunen van Delft - Sales Director, Oligo and Serum Specialist Teams - MilliporeSigma | LinkedIn
![Forests | Free Full-Text | Detection and Quantification of Serpula himantioides in the Wood of Chamaecyparis pisifera Butt Rot Trees by Real-Time PCR Forests | Free Full-Text | Detection and Quantification of Serpula himantioides in the Wood of Chamaecyparis pisifera Butt Rot Trees by Real-Time PCR](https://pub.mdpi-res.com/forests/forests-13-01429/article_deploy/html/images/forests-13-01429-g001.png?1662460888)
Forests | Free Full-Text | Detection and Quantification of Serpula himantioides in the Wood of Chamaecyparis pisifera Butt Rot Trees by Real-Time PCR
De novo sequencing and analysis of the transcriptome of two highbush blueberry (Vaccinium corymbosum L.) cultivars 'Bluecrop' and 'Legacy' at harvest and following post-harvest storage | PLOS ONE
![A novel molecular diagnostic method for the gut content analysis of Philaenus DNA | Scientific Reports A novel molecular diagnostic method for the gut content analysis of Philaenus DNA | Scientific Reports](https://media.springernature.com/full/springer-static/image/art%3A10.1038%2Fs41598-021-04422-1/MediaObjects/41598_2021_4422_Fig1_HTML.png)
A novel molecular diagnostic method for the gut content analysis of Philaenus DNA | Scientific Reports
![DNA&RNA Universe 💙 on Twitter: "Great apps for a lab life 🙂🧬👩🔬 #1 @Tocris molarity and dilution calculator https://t.co/3OH33acKXP https://t.co/M9Tseyn38j #ScienceTwitter https://t.co/1zdjbJLjQC" / Twitter DNA&RNA Universe 💙 on Twitter: "Great apps for a lab life 🙂🧬👩🔬 #1 @Tocris molarity and dilution calculator https://t.co/3OH33acKXP https://t.co/M9Tseyn38j #ScienceTwitter https://t.co/1zdjbJLjQC" / Twitter](https://pbs.twimg.com/media/FeigTjkX0AAbh6F.png)
DNA&RNA Universe 💙 on Twitter: "Great apps for a lab life 🙂🧬👩🔬 #1 @Tocris molarity and dilution calculator https://t.co/3OH33acKXP https://t.co/M9Tseyn38j #ScienceTwitter https://t.co/1zdjbJLjQC" / Twitter
![How to check the Oligo concentration or Primer Concentration from OD value using Oligo Calc - YouTube How to check the Oligo concentration or Primer Concentration from OD value using Oligo Calc - YouTube](https://i.ytimg.com/vi/-13riOgy0qU/hqdefault.jpg)
How to check the Oligo concentration or Primer Concentration from OD value using Oligo Calc - YouTube
DNA&RNA Universe 💙 on Twitter: "Great apps for a lab life 🙂🧬👩🔬 #1 @Tocris molarity and dilution calculator https://t.co/3OH33acKXP https://t.co/M9Tseyn38j #ScienceTwitter https://t.co/1zdjbJLjQC" / Twitter
![SOLVED: Design two primers that will completely amplify the following piece of DNA 5' 'GGATCGATCAAGAACAATGACAGGATCGAGGAATTCAGCCTACGCAGCCCGTAGCTGGAGGGA 3' 'CCTAGCTAGTTCTTGTTACTGTCCTAGCTCCTTAAGTCGGATGCGTCGGGCATCGACCTCCCT The primers should be 10 bases in ... SOLVED: Design two primers that will completely amplify the following piece of DNA 5' 'GGATCGATCAAGAACAATGACAGGATCGAGGAATTCAGCCTACGCAGCCCGTAGCTGGAGGGA 3' 'CCTAGCTAGTTCTTGTTACTGTCCTAGCTCCTTAAGTCGGATGCGTCGGGCATCGACCTCCCT The primers should be 10 bases in ...](https://cdn.numerade.com/ask_previews/5a690438-aa99-47b4-b2fb-2e799fc31c98_large.jpg)
SOLVED: Design two primers that will completely amplify the following piece of DNA 5' 'GGATCGATCAAGAACAATGACAGGATCGAGGAATTCAGCCTACGCAGCCCGTAGCTGGAGGGA 3' 'CCTAGCTAGTTCTTGTTACTGTCCTAGCTCCTTAAGTCGGATGCGTCGGGCATCGACCTCCCT The primers should be 10 bases in ...
![DNA&RNA Universe 💙 on Twitter: "Great apps for a lab life 🙂🧬👩🔬 #1 @Tocris molarity and dilution calculator https://t.co/3OH33acKXP https://t.co/M9Tseyn38j #ScienceTwitter https://t.co/1zdjbJLjQC" / Twitter DNA&RNA Universe 💙 on Twitter: "Great apps for a lab life 🙂🧬👩🔬 #1 @Tocris molarity and dilution calculator https://t.co/3OH33acKXP https://t.co/M9Tseyn38j #ScienceTwitter https://t.co/1zdjbJLjQC" / Twitter](https://pbs.twimg.com/media/Feicz2-XEAYr89I.png)
DNA&RNA Universe 💙 on Twitter: "Great apps for a lab life 🙂🧬👩🔬 #1 @Tocris molarity and dilution calculator https://t.co/3OH33acKXP https://t.co/M9Tseyn38j #ScienceTwitter https://t.co/1zdjbJLjQC" / Twitter
![Genes | Free Full-Text | Validation and Selection of New Reference Genes for RT-qPCR Analysis in Pediatric Glioma of Different Grades Genes | Free Full-Text | Validation and Selection of New Reference Genes for RT-qPCR Analysis in Pediatric Glioma of Different Grades](https://www.mdpi.com/genes/genes-12-01335/article_deploy/html/images/genes-12-01335-g001.png)